After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CDK2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_016756.4
Taille du ADNc:897bp
Description du ADNc:Full length Clone DNA of Mus musculus cyclin-dependent kinase 2, transcript variant 2 with N terminal Myc tag.
Synonyme du gène:A630093N05Rik, Cdk2
Espèces:Mouse
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50796-ACGCHF270
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50796-ACRCHF270
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50796-ANGCHF270
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50796-ANRCHF270
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50796-CFCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50796-CHCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50796-CMCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50796-CYCHF230
Souris CDK2 transcript variant 2 Gène ADNc clone le vecteur de clonageMG50796-GCHF90
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50796-NFCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50796-NHCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50796-NMCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50796-NYCHF230
Souris CDK2 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneMG50796-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. Although there are 12 different cdk genes, only 5 have been shown to directly drive the cell cycle (Cdk1, -2, -3, -4, and -6). Following extracellular mitogenic stimuli, cyclin D gene expression is upregulated. Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. Cdk4-cyclin E complexes form and initiate G1/S transition. Subsequently, Cdk1-cyclin B complexes form and induce G2/M phase transition. Cdk1-cyclin B activation induces the breakdown of the nuclear envelope and the initiation of mitosis. CDK2 associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. CDK2 is involved in the control of the cell cycle. It also interacts with cyclins A, B1, B3, D, or E. Activity of CDK2 is maximal during S phase and G2.

Références
  • Bao ZQ, et al. (2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. Structure. 19(5):675-90.
  • Neganova I, et al. (2011) An important role for CDK2 in G1 to S checkpoint activation and DNA damage response in human embryonic stem cells. Stem Cells. 29(4):651-9.
  • Li J, et al. (2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. J Biol Chem. 286(46):39776-85.
  • Buis J, et al. (2012) Mre11 regulates CtIP-dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol. 19(2):246-52.
  • Size / Price
    Catalogue : MG50796-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »