Commande rapide

Text Size:AAA

Souris FACTOR D/Adipsin expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CFD Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001291915.1
Taille du ADNc:777bp
Description du ADNc:Full length Clone DNA of Mus musculus complement factor D (adipsin) with N terminal HA tag.
Synonyme du gène:DF, Adn, Cfd
Espèces:Mouse
Vecteur:pCMV3-SP-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Mouse complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.

Références
  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.
  • Size / Price
    Catalogue : MG50539-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »