CIB2 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

CIB2 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Mouse calcium and integrin binding family member 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CIB2 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

2810434I23Rik cDNA ORF Clone, Mouse; AI449053 cDNA ORF Clone, Mouse

CIB2 Background Information

Calcium and integrin-binding protein 2 (CIB2) belongs to a protein family with four known members, CIB1 through CIB4, which are characterized by multiple calcium-binding EF-hand domains. Sensorineural hearing loss is genetically heterogeneous. The mutations in CIB2, which encodes a calcium- and integrin-binding protein, are associated with nonsyndromic deafness (DFNB48) and Usher syndrome type 1J (USH1J). Furthermore, in zebrafish and Drosophila melanogaster, CIB2 is essential for the function and proper development of hair cells and retinal photoreceptor cells. We also show that CIB2 is a new member of the vertebrate Usher interactome. Variants in CIB2 can underlie either Usher syndrome type I (USH1J) or nonsyndromic hearing impairment (NSHI) (DFNB48). CIB2 is widely expressed in various human and animal tissues, mainly in skeletal muscle, nervous tissue, inner ear, and retina. The CIB2 protein is responsible for maintaining Ca(2+) homeostasis in cells and interacting with integrins-transmembrane receptors essential for cell adhesion, migration, and activation of signaling pathways. Calcium signaling pathway is crucial for signal transduction in the inner ear, and integrins regulate hair cell differentiation and maturation of the stereocilia.
Full Name
calcium and integrin binding family member 2
References
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait