After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CKB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_021273.4
Taille du ADNc:1146bp
Description du ADNc:Full length Clone DNA of Mus musculus creatine kinase, brain.
Synonyme du gène:Bck, Ck3, B-CK, Ck-3, Ckbb
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51386-ACGCHF270
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51386-ACRCHF270
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51386-ANGCHF270
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51386-ANRCHF270
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51386-CFCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51386-CHCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51386-CMCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51386-CYCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51386-NFCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51386-NHCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51386-NMCHF230
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51386-NYCHF230
Souris CKB / Creatine kinase B type Gène ADNc clone le vecteur de clonageMG51386-UCHF90
Souris CKB / Creatine kinase B type expression plasmide de Gène l'ADNc ORF cloneMG51386-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Références
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Catalogue : MG51386-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »