Commande rapide

Souris CKM / CK-MM expression plasmide de Gène l'ADNc ORF clone

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Fiche techniqueCommentairesProduits apparentésProtocoles
Souris CKM Informations sur les produits clonés de cDNA
Gene_bank_ref_id:X03233.1
Taille du ADNc:1146bp
Description du ADNc:Full length Clone DNA of Mus musculus creatine kinase, muscle.
Synonyme du gène:MCK, Ckmm, M-CK
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:pCMV3-mCKM
Site de restriction:KpnI + XbaI(6.1kb+1.15kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 147C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CKM qPCR primers for gene expression analysis, MP201233 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

Références
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Catalogue : MG51356-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »