CKM cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

CKM cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1146 bp
Description
Full length Clone DNA of Mouse creatine kinase, muscle with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CKM cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

Ckmm cDNA ORF Clone, Mouse; M-CK cDNA ORF Clone, Mouse; MCK cDNA ORF Clone, Mouse

CKM Background Information

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).
Full Name
creatine kinase, muscle
References
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
Add to Cart Successfully Add to Cart Failed