Commande rapide

Mouse CLEC12A ORF mammalian expression plasmid, N-HA tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CLEC12A Informations sur les produits clonés de cDNA
Taille du ADNc:804bp
Description du ADNc:Full length Clone DNA of Mus musculus C-type lectin domain family 12, member a with N terminal HA tag.
Synonyme du gène:Micl, CLL-1, D230024O04, Clec12a
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. CLEC12A is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. C-type lectins are the most diverse and prevalent lectin family in immunity. Using a novel CLEC12A -specific monoclonal antibody, experiments had shown that human CLEC12A was expressed primarily on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. Although CLEC12A was highly N-glycosylated in primary cells, the level of glycosylation was found to vary between cell types. CLEC12A surface expression was down-regulated during inflammatory/activation conditions in vitro, as well as during an in vivo model of acute inflammation. This suggests that CLEC12A may be involved in the control of myeloid cell activation during inflammation.

  • Lahoud MH, et al. (2009) The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses. J Immunol. 182(12): 7587-94.
  • Pyz E, et al. (2008) Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand. Eur J Immunol. 38(4): 1157-63.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36(8): 2159-69.
  • Size / Price
    Catalogue : MG50558-NY
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.