CNOT8 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

CNOT8 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Mouse CCR4-NOT transcription complex, subunit 8 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CNOT8 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1500015I04Rik cDNA ORF Clone, Mouse; 1810022F04Rik cDNA ORF Clone, Mouse; AA536816 cDNA ORF Clone, Mouse; AU015770 cDNA ORF Clone, Mouse; AU043059 cDNA ORF Clone, Mouse

CNOT8 Background Information

Full Name
CCR4-NOT transcription complex, subunit 8
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait