COA6/C1orf31 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52528-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COA6/C1orf31 Reagents
CRO Services
Product recommended

All COA6/C1orf31 Reagents
COA6/C1orf31 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
240 bp
Description
Full length Clone DNA of Mouse cytochrome c oxidase assembly factor 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COA6/C1orf31 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1810063B05Rik cDNA ORF Clone, Mouse;AI447995 cDNA ORF Clone, Mouse
COA6/C1orf31 Background Information
Full Name
cytochrome c oxidase assembly factor 6

COA6/C1orf31 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COA6/C1orf31 cDNA ORF Clone in Cloning Vector, Mouse MG52528-U
COA6/C1orf31 cDNA ORF Clone, Mouse, untagged MG52528-UT
COA6/C1orf31 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52528-ACG
COA6/C1orf31 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52528-ACGLN
COA6/C1orf31 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52528-ANG
COA6/C1orf31 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52528-ACR
COA6/C1orf31 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52528-ANR
COA6/C1orf31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52528-CF
COA6/C1orf31 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52528-NF
COA6/C1orf31 cDNA ORF Clone, Mouse, C-His tag MG52528-CH
COA6/C1orf31 cDNA ORF Clone, Mouse, C-HA tag MG52528-CY
COA6/C1orf31 cDNA ORF Clone, Mouse, N-HA tag MG52528-NY
COA6/C1orf31 cDNA ORF Clone, Mouse, C-Myc tag MG52528-CM
COA6/C1orf31 cDNA ORF Clone, Mouse, N-Myc tag MG52528-NM
COA6/C1orf31 qPCR Primer Pairs, Mouse MP202401

COA6/C1orf31 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COA6/C1orf31 cDNA ORF Clone in Cloning Vector, Human HG23667-U
COA6/C1orf31 cDNA ORF Clone, Human, untagged HG23667-UT
COA6/C1orf31 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23667-ACGLN
COA6/C1orf31 cDNA ORF Clone, Human, C-GFPSpark® tag HG23667-ACG
COA6/C1orf31 cDNA ORF Clone, Human, N-GFPSpark® tag HG23667-ANG
COA6/C1orf31 cDNA ORF Clone, Human, C-OFPSpark® tag HG23667-ACR
COA6/C1orf31 cDNA ORF Clone, Human, N-OFPSpark® tag HG23667-ANR
COA6/C1orf31 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23667-CF
COA6/C1orf31 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23667-NF
COA6/C1orf31 cDNA ORF Clone, Human, C-His tag HG23667-CH
COA6/C1orf31 cDNA ORF Clone, Human, N-His tag HG23667-NH
COA6/C1orf31 cDNA ORF Clone, Human, C-HA tag HG23667-CY
COA6/C1orf31 cDNA ORF Clone, Human, N-HA tag HG23667-NY
COA6/C1orf31 cDNA ORF Clone, Human, C-Myc tag HG23667-CM
COA6/C1orf31 cDNA ORF Clone, Human, N-Myc tag HG23667-NM
info info
添加购物车成功! 添加购物车失败!