After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse COX6C Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_053071.2
Taille du ADNc:231bp
Description du ADNc:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit Vic.
Synonyme du gène:Cox6c
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51387-ACGCHF270
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51387-ACRCHF270
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51387-ANGCHF270
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51387-ANRCHF270
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51387-CFCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51387-CHCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51387-CMCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51387-CYCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51387-NFCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51387-NHCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51387-NMCHF230
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51387-NYCHF230
Souris Cytochrome C Oxidase subunit VIc Gène ADNc clone le vecteur de clonageMG51387-UCHF90
Souris Cytochrome C Oxidase subunit VIc expression plasmide de Gène l'ADNc ORF cloneMG51387-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51387-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »