After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris CRABP2 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CRABP2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_007759.2
Taille du ADNc:417bp
Description du ADNc:Full length Clone DNA of Mus musculus cellular retinoic acid binding protein II with N terminal HA tag.
Synonyme du gène:Crabp-2, CrabpII, AI893628, Crabp2
Espèces:Mouse
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

Références
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Catalogue : MG50535-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »