Commande rapide

Text Size:AAA

Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CRYM Informations sur les produits clonés de cDNA
Taille du ADNc:942bp
Description du ADNc:Full length Clone DNA of Mus musculus crystallin, mu with C terminal HA tag.
Synonyme du gène:Crym
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51760-ACGCHF390
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51760-ACRCHF390
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51760-ANGCHF390
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51760-ANRCHF390
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51760-CFCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51760-CHCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51760-CMCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51760-CYCHF350
Mouse CRYM Gene cDNA clone plasmidMG51760-GCHF90
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51760-NFCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51760-NHCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51760-NMCHF350
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51760-NYCHF350
Souris mu Crystallin/CRYM Gène ADNc clone le vecteur de clonageMG51760-UCHF110
Souris mu Crystallin/CRYM expression plasmide de Gène l'ADNc ORF cloneMG51760-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51760-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.