Commande rapide

Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris CS Informations sur les produits clonés de cDNA
    Taille du ADNc:1395bp
    Description du ADNc:Full length Clone DNA of Mus musculus citrate synthase with N terminal His tag.
    Synonyme du gène:Cis; ahl4; BB234005; 2610511A05Rik; 9030605P22Rik
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    ( We provide with CS qPCR primers for gene expression analysis, MP202422 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52549-ACGCHF270
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52549-ACRCHF270
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52549-ANGCHF270
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52549-ANRCHF270
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52549-CFCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52549-CHCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52549-CMCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52549-CYCHF230
    Mouse CS Gene cDNA clone plasmidMG52549-GCHF90
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52549-NFCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52549-NHCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52549-NMCHF230
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52549-NYCHF230
    Souris citrate synthase / CS Gène ADNc clone le vecteur de clonageMG52549-UCHF90
    Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF cloneMG52549-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : MG52549-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.