After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CS Informations sur les produits clonés de cDNA
Taille du ADNc:1395bp
Description du ADNc:Full length Clone DNA of Mus musculus citrate synthase with N terminal His tag.
Synonyme du gène:Cis; ahl4; BB234005; 2610511A05Rik; 9030605P22Rik
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52549-ACGCHF270
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52549-ACRCHF270
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52549-ANGCHF270
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52549-ANRCHF270
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52549-CFCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52549-CHCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52549-CMCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52549-CYCHF230
Mouse CS Gene cDNA clone plasmidMG52549-GCHF90
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52549-NFCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52549-NHCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52549-NMCHF230
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52549-NYCHF230
Souris citrate synthase / CS Gène ADNc clone le vecteur de clonageMG52549-UCHF90
Souris citrate synthase / CS expression plasmide de Gène l'ADNc ORF cloneMG52549-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG52549-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.