Citrate Synthase cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

Citrate Synthase cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Mouse citrate synthase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Citrate Synthase cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

2610511A05Rik cDNA ORF Clone, Mouse; 9030605P22Rik cDNA ORF Clone, Mouse; ahl4 cDNA ORF Clone, Mouse; BB234005 cDNA ORF Clone, Mouse; Cis cDNA ORF Clone, Mouse

Citrate Synthase Background Information

Chondroitin sulphate (CS) glycosaminoglycan chains on cell and extracellular matrix proteoglycans (PGs) can no longer be regarded as merely hydrodynamic space fillers. Overwhelming evidence over recent years indicates that sulphation motif sequences within the CS chain structure are a source of significant biological information to cells and their surrounding environment. CS sulphation motifs have been shown to interact with a wide variety of bioactive molecules, e.g. cytokines, growth factors, chemokines, morphogenetic proteins, enzymes and enzyme inhibitors, as well as structural components within the extracellular milieu. They are therefore capable of modulating a panoply of signalling pathways, thus controlling diverse cellular behaviours including proliferation, differentiation, migration and matrix synthesis. Chondroitin sulfate (CS) is a sulfated glycosaminoglycan composed of a long chain of repeating disaccharide units that are attached to core proteins, resulting in CS proteoglycans (CSPGs). In the mature brain, CS is concentrated in perineuronal nets (PNNs), which are extracellular structures that surround synapses and regulate synaptic plasticity. In addition, CS is rapidly synthesized after CNS injury to create a physical and chemical barrier that inhibits axon growth.
Full Name
citrate synthase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait