Casein Kinase 1 alpha / CSNK1A1 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

Casein Kinase 1 alpha / CSNK1A1 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Mouse casein kinase 1, alpha 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Casein Kinase 1 alpha / CSNK1A1 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

2610208K14Rik cDNA ORF Clone, Mouse; 4632404G05Rik cDNA ORF Clone, Mouse; 5430427P18Rik cDNA ORF Clone, Mouse; CK1a cDNA ORF Clone, Mouse; Csnk1a cDNA ORF Clone, Mouse

Casein Kinase 1 alpha / CSNK1A1 Background Information

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to theprotein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.
Full Name
casein kinase 1, alpha 1
References
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait