CXCR3 cDNA ORF Clone, Mouse, C-HA tag

1/1
Price:
Size:
Number:

CXCR3 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) receptor 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.15kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCR3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR3 cDNA ORF Clone, Mouse, C-HA tag: Validated Images

CXCR3 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

Cd183 cDNA ORF Clone, Mouse; Cmkar3 cDNA ORF Clone, Mouse

CXCR3 Background Information

The chemokine receptor CXCR3 plays an important role in T cell recruitment in various immune responses and autoimmune diseases. CXCR3 overexpression in GC is associated with increased DC and TIL infiltration and improved OS, and thus could be further exploited as a biomarker of favorable prognosis and a therapeutic target in GC. CXCR3 is a chemokine receptor expressed on a wide range of leukocytes, and it is involved in leukocyte migration throughout the blood and lymphatics.
Full Name
chemokine (C-X-C motif) receptor 3

CXCR3 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait