CXCR5 cDNA ORF Clone, Mouse, C-HA tag

1/2
Price:
Size:
Number:

CXCR5 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 969C/T, not causing the amino acid variation.
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) receptor 5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 1.17kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCR5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR5 cDNA ORF Clone, Mouse, C-HA tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-HA Tag monoclonal antibody (100028-MM10) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CXCR5 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

Blr1 cDNA ORF Clone, Mouse; CXC-R5 cDNA ORF Clone, Mouse; CXCR-5 cDNA ORF Clone, Mouse; Gpcr6 cDNA ORF Clone, Mouse; MDR15 cDNA ORF Clone, Mouse

CXCR5 Background Information

Because of the level of attention it received due to its role as the principal HIV coreceptor, CCR5 has been described as a 'celebrity' chemokine receptor. The wealth of CCR5-related tools that have been developed during the intensive investigation of CCR5 as an HIV drug target can now be turned towards the study of CCR5 as a model chemokine receptor. The enforced expression of CXCR5 onto Treg cells efficiently induces Tfr cell-like properties, which might be a promising cellular therapeutic approach for the treatment of antibody-mediated autoimmune diseases. The Chemokine receptor 5 (CCR5) is implicated in immune cell migration and cytokine release in the CNS, and it was demonstrated to strongly contribute to CNS inflammation and damage in several models of sterile and pathogen-mediated CNS diseases.
Full Name
chemokine (C-X-C motif) receptor 5

CXCR5 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait