Commande rapide

Text Size:AAA

Souris DARS expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse DARS Informations sur les produits clonés de cDNA
Taille du ADNc:1506bp
Description du ADNc:Full length Clone DNA of Mus musculus aspartyl-tRNA synthetase with C terminal Flag tag.
Synonyme du gène:5730439G15Rik
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Aspartate tRNA ligase 1, also known as DARS, is part of a multienzyme complex of aminoacyl-tRNA synthetases. It belongs to the class-II aminoacyl-tRNA synthetase family. DARS charges its cognate tRNA with aspartate during protein biosynthesis. DARS catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid(AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.

  • Escalante C, et al. (1993) Expression of human aspartyl-tRNA synthetase in Escherichia coli. Functional analysis of the N-terminal putative amphiphilic helix. J Biol Chem. 268(8): 6014-23.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Reed VS, et al. (1995) Mechanisms of the transfer of aminoacyl-tRNA from aminoacyl-tRNA synthetase to the elongation factor 1 alpha. J Biol Chem. 269(52):32932-6.
  • Size / Price
    Catalogue : MG52211-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.