DAZAP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

DAZAP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Mouse DAZ associated protein 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DAZAP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

AI314727 cDNA ORF Clone, Mouse; Brbp cDNA ORF Clone, Mouse; Gcap28 cDNA ORF Clone, Mouse; gt6-12 cDNA ORF Clone, Mouse; mKIAA0058 cDNA ORF Clone, Mouse; Prtb cDNA ORF Clone, Mouse

DAZAP2 Background Information

Full Name
DAZ associated protein 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait