After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse DDC Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001190448.1
Taille du ADNc:1443bp
Description du ADNc:Full length Clone DNA of Mus musculus dopa decarboxylase with N terminal Myc tag.
Synonyme du gène:Aadc, Ddc
Espèces:Mouse
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50799-ACGCHF270
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50799-ACRCHF270
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50799-ANGCHF270
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50799-ANRCHF270
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50799-CFCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50799-CHCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50799-CMCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50799-CYCHF230
Souris DOPA Decarboxylase/DDC Gène ADNc clone le vecteur de clonageMG50799-GCHF90
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50799-NFCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50799-NHCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50799-NMCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50799-NYCHF230
Souris DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF cloneMG50799-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

Références
  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catalogue : MG50799-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »