DPAGT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52771-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DPAGT1 Reagents
CRO Services
Product recommended

All DPAGT1 Reagents
DPAGT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Description
Full length Clone DNA of Mouse dolichyl-phosphate (UDP-N-acetylglucosamine) acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPAGT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AU021132 cDNA ORF Clone, Mouse;Dpagt2 cDNA ORF Clone, Mouse;Gnpta cDNA ORF Clone, Mouse;GPT cDNA ORF Clone, Mouse
DPAGT1 Background Information
Full Name
dolichyl-phosphate N-acetylglucosaminephosphotransferase 1

DPAGT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DPAGT1 cDNA ORF Clone in Cloning Vector, Rat RG80951-U
DPAGT1 cDNA ORF Clone, Rat, untagged RG80951-UT
DPAGT1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80951-ACG
DPAGT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80951-ACGLN
DPAGT1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80951-ACR
DPAGT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80951-CF
DPAGT1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80951-NF
DPAGT1 cDNA ORF Clone, Rat, C-His tag RG80951-CH
DPAGT1 cDNA ORF Clone, Rat, N-His tag RG80951-NH
DPAGT1 cDNA ORF Clone, Rat, C-HA tag RG80951-CY
DPAGT1 cDNA ORF Clone, Rat, N-HA tag RG80951-NY
DPAGT1 cDNA ORF Clone, Rat, C-Myc tag RG80951-CM
DPAGT1 cDNA ORF Clone, Rat, N-Myc tag RG80951-NM
DPAGT1 qPCR Primer Pairs, Rat RP300915

DPAGT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DPAGT1 cDNA ORF Clone in Cloning Vector, Mouse MG52771-G
DPAGT1 cDNA ORF Clone, Mouse, untagged MG52771-UT
DPAGT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52771-ACG
DPAGT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52771-ACGLN
DPAGT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52771-ACR
DPAGT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52771-NF
DPAGT1 cDNA ORF Clone, Mouse, C-His tag MG52771-CH
DPAGT1 cDNA ORF Clone, Mouse, N-His tag MG52771-NH
DPAGT1 cDNA ORF Clone, Mouse, C-HA tag MG52771-CY
DPAGT1 cDNA ORF Clone, Mouse, N-HA tag MG52771-NY
DPAGT1 cDNA ORF Clone, Mouse, C-Myc tag MG52771-CM
DPAGT1 cDNA ORF Clone, Mouse, N-Myc tag MG52771-NM

DPAGT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DPAGT1 cDNA ORF Clone in Cloning Vector, Human HG16461-G
DPAGT1 cDNA ORF Clone, Human, untagged HG16461-UT
DPAGT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16461-ACG
DPAGT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16461-ACGLN
DPAGT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16461-ACR
DPAGT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16461-CF
DPAGT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16461-NF
DPAGT1 cDNA ORF Clone, Human, C-His tag HG16461-CH
DPAGT1 cDNA ORF Clone, Human, N-His tag HG16461-NH
DPAGT1 cDNA ORF Clone, Human, C-HA tag HG16461-CY
DPAGT1 cDNA ORF Clone, Human, N-HA tag HG16461-NY
DPAGT1 cDNA ORF Clone, Human, C-Myc tag HG16461-CM
DPAGT1 cDNA ORF Clone, Human, N-Myc tag HG16461-NM
DPAGT1 qPCR Primer Pairs, Human HP105206
info info
添加购物车成功! 添加购物车失败!