Commande rapide

Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Souris DYNC1I1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010063.4
Taille du ADNc:1887bp
Description du ADNc:Full length Clone DNA of Mus musculus dynein cytoplasmic 1 intermediate chain 1.
Synonyme du gène:DIC, IC74, DHIC-1, Dncic1, DH IC-1
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DYNC1I1 qPCR primers for gene expression analysis, MP201245 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51372-ACGCHF290
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51372-ACRCHF290
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51372-ANGCHF290
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51372-ANRCHF290
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51372-CFCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51372-CHCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51372-CMCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51372-CYCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51372-NFCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51372-NHCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51372-NMCHF260
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51372-NYCHF260
Souris Dynein intermediate chain 1 Gène ADNc clone le vecteur de clonageMG51372-UCHF90
Souris Dynein intermediate chain 1 expression plasmide de Gène l'ADNc ORF cloneMG51372-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51372-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »