After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris 4E-BP1/EIF4EBP1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse EIF4EBP1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_007918.3
Taille du ADNc:354bp
Description du ADNc:Full length Clone DNA of Mus musculus Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal His tag.
Synonyme du gène:4e-bp1, PHAS-I
Espèces:Mouse
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Souris 4E-BP1/EIF4EBP1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Product nameProduct name
Fond

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

Références
  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    Catalogue : MG50739-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »