After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ELANE Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_015779.2
Taille du ADNc:798bp
Description du ADNc:Full length Clone DNA of Mus musculus elastase, neutrophil expressed with N terminal Myc tag.
Synonyme du gène:NE, F430011M15Rik, Ela2
Espèces:Mouse
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50204-ACGCHF270
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50204-ACRCHF270
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50204-ANGCHF270
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50204-ANRCHF270
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50204-CFCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50204-CHCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50204-CMCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50204-CYCHF230
Souris ELA2/Neutrophil Elastase Gène ADNc clone le vecteur de clonageMG50204-MCHF90
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50204-NFCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50204-NHCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50204-NMCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50204-NYCHF230
Souris ELA2/Neutrophil Elastase expression plasmide de Gène l'ADNc ORF cloneMG50204-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Mouse Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.

Size / Price
Catalogue : MG50204-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »