ELP2/STATIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

ELP2/STATIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2496 bp
Description
Full length Clone DNA of Mouse elongator acetyltransferase complex subunit 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ELP2/STATIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

AU023723 cDNA ORF Clone, Mouse; Epl2 cDNA ORF Clone, Mouse; Statip1 cDNA ORF Clone, Mouse; StIP1 cDNA ORF Clone, Mouse

ELP2/STATIP1 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait