Commande rapide

Text Size:AAA

Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris EMC6 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_025318.3
    Taille du ADNc:333bp
    Description du ADNc:Full length Clone DNA of Mus musculus ER membrane protein complex subunit 6 with N terminal Myc tag.
    Synonyme du gène:Tmem93; 0610009E20Rik; 0610025L18Rik
    Espèces:Mouse
    Vecteur:pCMV3-N-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EMC6 qPCR primers for gene expression analysis, MP201347 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51463-ACGCHF270
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51463-ACRCHF270
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51463-ANGCHF270
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51463-ANRCHF270
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51463-CFCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51463-CHCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51463-CMCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51463-CYCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51463-NFCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51463-NHCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51463-NMCHF230
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51463-NYCHF230
    Souris Transmembrane Protéine 93 Gène ADNc clone le vecteur de clonageMG51463-UCHF90
    Souris Transmembrane Protéine 93 expression plasmide de Gène l'ADNc ORF cloneMG51463-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »