After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Mouse ENTPD3 natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ENTPD3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_178676.3
Taille du ADNc:1590bp
Description du ADNc:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 3.
Synonyme du gène:HB6, Cd39l3, NTPDase-3, 6330566B20, Entpd3
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Références
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • Size / Price
    Catalogue : MG50269-UT
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeksInstructions d’expédition
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »