Commande rapide

Souris ERK2/MAPK1/MAPK2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse MAPK1 Informations sur les produits clonés de cDNA
Taille du ADNc:1074bp
Description du ADNc:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 1 with N terminal Flag tag.
Synonyme du gène:ERK, Erk2, MAPK2, PRKM2, Prkm1, C78273, p41mapk, p42mapk, AA407128, AU018647, 9030612K14Rik, Mapk1
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris ERK2/MAPK1/MAPK2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Product nameProduct name

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.
  • Size / Price
    Catalogue : MG50445-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.