ERK2 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

ERK2 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ERK2 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

9030612K14Rik cDNA ORF Clone, Mouse; AA407128 cDNA ORF Clone, Mouse; AU018647 cDNA ORF Clone, Mouse; C78273 cDNA ORF Clone, Mouse; ERK cDNA ORF Clone, Mouse; Erk2 cDNA ORF Clone, Mouse; MAPK2 cDNA ORF Clone, Mouse; p41mapk cDNA ORF Clone, Mouse; p42mapk cDNA ORF Clone, Mouse; Prkm1 cDNA ORF Clone, Mouse; PRKM2 cDNA ORF Clone, Mouse

ERK2 Background Information

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.
Full Name
mitogen-activated protein kinase 1
Research Areas
References
  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.

ERK2 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait