Commande rapide

Text Size:AAA

Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse F3 Informations sur les produits clonés de cDNA
Taille du ADNc:885bp
Description du ADNc:Full length Clone DNA of Mus musculus coagulation factor III with C terminal Flag tag.
Synonyme du gène:TF, Cf3, Cf-3, CD142, AA409063, F3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50413-ACGCHF270
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50413-ACRCHF270
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50413-CFCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50413-CHCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50413-CMCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50413-CYCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 Gène ADNc clone le vecteur de clonageMG50413-MCHF90
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50413-NFCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50413-NHCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50413-NMCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50413-NYCHF230
Souris Coagulation Factor III / Tissue Factor / CD142 expression plasmide de Gène l'ADNc ORF cloneMG50413-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • Size / Price
    Catalogue : MG50413-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.