FAM126B cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

FAM126B cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1761 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 126, member B with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM126B cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

C130065N10Rik cDNA ORF Clone, Mouse; D1Ertd53e cDNA ORF Clone, Mouse; D630010C10 cDNA ORF Clone, Mouse

FAM126B Background Information

Full Name
family with sequence similarity 126, member B

FAM126B cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait