NIP30 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

NIP30 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 192, member A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NIP30 cDNA ORF Clone, Mouse, untagged: Alternative Names

1700001O11Rik cDNA ORF Clone, Mouse; 2310065K24Rik cDNA ORF Clone, Mouse; AI596259 cDNA ORF Clone, Mouse; Nip30 cDNA ORF Clone, Mouse

NIP30 Background Information

Full Name
family with sequence similarity 192, member A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait