FGF18 cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

FGF18 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
624 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse fibroblast growth factor 18 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.67kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF18 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF18 cDNA ORF Clone, Mouse, C-His tag: Validated Images

FGF18 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

D130055P09Rik cDNA ORF Clone, Mouse; FGF-18 cDNA ORF Clone, Mouse

FGF18 Background Information

Fibroblast growth factor 18 (FGF18) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that FGF18 is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Experiment datas identified FGF18 as a selective ligand for FGFR3 in limb bud mesenchymal cells, which suppressed proliferation and promoted their differentiation and production of cartilage matrix. FGF18 appears to regulate cell proliferation and differentiation positively in osteogenesis and negatively in chondrogenesis.
Full Name
fibroblast growth factor 18
References
  • Ohbayashi N, et al. (2002) FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev. 16(7): 870-9.
  • Davidson D, et al. (2005) Fibroblast growth factor (FGF) 18 signals through FGF receptor 3 to promote chondrogenesis. J Biol Chem. 280(21): 20509-15.
  • Liu Z, et al. (2007) FGF18 is required for early chondrocyte proliferation, hypertrophy and vascular invasion of the growth plate. Dev Biol. 302(1): 80-91.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait