Commande rapide

Souris FGFR4/CD334 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse FGFR4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008011.2
Taille du ADNc:2400bp
Description du ADNc:Full length Clone DNA of Mus musculus fibroblast growth factor receptor 4 with N terminal Myc tag.
Synonyme du gène:Fgfr-4, Fgfr4
Espèces:Mouse
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth factor receptor, is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR4/CD334 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR4/CD334 preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. FGFR4/CD334 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4/CD334. Mutations in FGFR4/CD334 lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling.

Références
  • Hart KC, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19(29): 3309-20.
  • Xie MH, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 11(10): 729-35.
  • Yu C, et al. (2000) Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 275(20): 15482-9.
  • Size / Price
    Catalogue : MG50194-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »