FRG1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

FRG1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Mouse FSHD region gene 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FRG1 Background Information

Facioscapulohumeral muscular dystrophy (FSHD) is a common muscle disease. Over-expression of FSHD region gene 1 (FRG1) in mice, frogs, and worms perturbs muscle development and causes FSHD-like phenotypes. FRG1 is also important for the normal muscular and vascular development. FRG1 is involved in the morphogenesis of the tooth germ, as well as in the formation of enamel and dentin matrices and that FRG1 may play a role in the odontogenesis in the mouse following BMP4 stimulation. In mammalian cells, FRG1 is a dynamic nuclear and cytoplasmic protein, however in muscle, FRG1 is also a developmentally regulated sarcomeric protein suggesting FRG1 may perform a muscle-specific function. Thus, FRG1 is the only FSHD candidate protein linked to the muscle contractile machinery and may address why the musculature and vasculature are specifically susceptible in FSHD. The FRG1 protein is highly conserved and contains a lipocalin sequence motif, suggesting it may function as a transport protein.
Full Name
FSHD region gene 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait