Commande rapide

Text Size:AAA

Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris GALE Informations sur les produits clonés de cDNA
    Taille du ADNc:1044bp
    Description du ADNc:Full length Clone DNA of Mus musculus galactose-4-epimerase, UDP with C terminal HA tag.
    Synonyme du gène:AI323962, 2310002A12Rik
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    ( We provide with GALE qPCR primers for gene expression analysis, MP201643 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51770-ACGCHF270
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51770-ACRCHF270
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51770-ANGCHF270
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51770-ANRCHF270
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51770-CFCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51770-CHCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51770-CMCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51770-CYCHF230
    Souris UDP galactose-4'-epimerase / GALE Gène ADNc clone le vecteur de clonageMG51770-GCHF90
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51770-NFCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51770-NHCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51770-NMCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51770-NYCHF230
    Souris UDP galactose-4'-epimerase / GALE expression plasmide de Gène l'ADNc ORF cloneMG51770-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name

    UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    Catalogue : MG51770-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.