GGT1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

GGT1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1707 bp
Description
Full length Clone DNA of Mouse gamma-glutamyltransferase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GGT1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

CD224 cDNA ORF Clone, Mouse; dwg cDNA ORF Clone, Mouse; GGT cDNA ORF Clone, Mouse; GGT-1 cDNA ORF Clone, Mouse; GGT1 cDNA ORF Clone, Mouse; Ggtp cDNA ORF Clone, Mouse

GGT1 Background Information

GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.
Full Name
gamma-glutamyltransferase 1
References
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.

GGT1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait