Commande rapide

Souris GMPR / GMPR1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris GMPR Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_025508.4
    Taille du ADNc:1038bp
    Description du ADNc:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
    Synonyme du gène:AV028449, 2310004P21Rik
    Espèces:Mouse
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GMPR qPCR primers for gene expression analysis, MP201265 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fond

    GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

    Size / Price
    Catalogue : MG51395-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »