GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
534 bp
Description
Full length Clone DNA of Mouse glycoprotein 9 (platelet).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged: Alternative Names

Cd42 cDNA ORF Clone, Mouse; GPIX cDNA ORF Clone, Mouse

GP9/GPIX/CD42a Background Information

Full Name
glycoprotein IX (platelet)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait