GPR83 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52701-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GPR83 Reagents

CRO Services

Product recommended


All GPR83 Reagents

GPR83 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1146 bp
Description
Full length Clone DNA of Mouse G protein-coupled receptor 83 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPR83 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

AW045253 cDNA ORF Clone, Mouse;Gir cDNA ORF Clone, Mouse;Gpr72 cDNA ORF Clone, Mouse;RP105 cDNA ORF Clone, Mouse;RP39 cDNA ORF Clone, Mouse;RP82 cDNA ORF Clone, Mouse

GPR83 Background Information

Full Name
G protein-coupled receptor 83

GPR83 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPR83 cDNA ORF Clone in Cloning Vector, Mouse MG52701-U
GPR83 cDNA ORF Clone, Mouse, untagged MG52701-UT
GPR83 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52701-ACG
GPR83 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52701-ACGLN
GPR83 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52701-ACR
GPR83 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52701-CF
GPR83 cDNA ORF Clone, Mouse, C-His tag MG52701-CH
GPR83 cDNA ORF Clone, Mouse, N-His tag MG52701-NH
GPR83 cDNA ORF Clone, Mouse, C-HA tag MG52701-CY
GPR83 cDNA ORF Clone, Mouse, N-HA tag MG52701-NY
GPR83 cDNA ORF Clone, Mouse, C-Myc tag MG52701-CM
GPR83 cDNA ORF Clone, Mouse, N-Myc tag MG52701-NM
GPR83 qPCR Primer Pairs, Mouse MP202572

GPR83 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPR83 cDNA ORF Clone in Cloning Vector, Human HG13837-G
GPR83 cDNA ORF Clone, Human, untagged HG13837-UT
GPR83 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13837-ACGLN
GPR83 cDNA ORF Clone, Human, C-GFPSpark® tag HG13837-ACG
GPR83 cDNA ORF Clone, Human, C-OFPSpark® tag HG13837-ACR
GPR83 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13837-CF
GPR83 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13837-NF
GPR83 cDNA ORF Clone, Human, C-His tag HG13837-CH
GPR83 cDNA ORF Clone, Human, N-His tag HG13837-NH
GPR83 cDNA ORF Clone, Human, C-HA tag HG13837-CY
GPR83 cDNA ORF Clone, Human, N-HA tag HG13837-NY
GPR83 cDNA ORF Clone, Human, C-Myc tag HG13837-CM
GPR83 cDNA ORF Clone, Human, N-Myc tag HG13837-NM
GPR83 qPCR Primer Pairs, Human HP102509
info info
添加购物车成功! 添加购物车失败!