GRPEL2 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

GRPEL2 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse GrpE-like 2, mitochondrial.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRPEL2 cDNA ORF Clone, Mouse, untagged: Alternative Names

mt-GrpE#2 cDNA ORF Clone, Mouse; mt-Grpel2 cDNA ORF Clone, Mouse

GRPEL2 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait