After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris HDAC8 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse HDAC8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_027382.3
Taille du ADNc:1134bp
Description du ADNc:Full length Clone DNA of Mus musculus histone deacetylase 8.
Synonyme du gène:2610007D20Rik
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

Références
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Catalogue : MG50273-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »