Commande rapide

Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse HEXB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010422.2
Taille du ADNc:1611bp
Description du ADNc:Full length Clone DNA of Mus musculus hexosaminidase B with N terminal HA tag.
Synonyme du gène:Hexb
Espèces:Mouse
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52038-ACGCHF290
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52038-ACRCHF290
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52038-ANGCHF290
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52038-ANRCHF290
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52038-CFCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52038-CHCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52038-CMCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52038-CYCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52038-NFCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52038-NHCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52038-NMCHF260
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52038-NYCHF260
Souris HEXB / Hexosaminidase B Gène ADNc clone le vecteur de clonageMG52038-UCHF90
Souris HEXB / Hexosaminidase B expression plasmide de Gène l'ADNc ORF cloneMG52038-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG52038-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »