After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris HSPA8/HSC70 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse HSPA8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_031165
Taille du ADNc:1941bp
Description du ADNc:Full length Clone DNA of Mus musculus heat shock protein 8 with C terminal HA tag.
Synonyme du gène:Hsc70; Hsc71; Hsc73; Hsp73; Hspa10; 2410008N15Rik
Espèces:Mouse
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris HSPA8/HSC70 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Product nameProduct name
Fond

HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

Références
  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • Size / Price
    Catalogue : MG51191-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »