Commande rapide

Souris IFNAR1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Souris IFNAR1 Informations sur les produits clonés de cDNA
Taille du ADNc:1773bp
Description du ADNc:Full length Clone DNA of Mus musculus interferon (alpha and beta) receptor 1 with C terminal His tag.
Synonyme du gène:Ifar, Ifrc, CD118, Ifnar, Infar, Ifnar1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with IFNAR1 qPCR primers for gene expression analysis, MP200077 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    Catalogue : MG50469-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.