Commande rapide

Text Size:AAA

Souris IGFBP6 / IBP6 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IGFBP6 Informations sur les produits clonés de cDNA
Taille du ADNc:717bp
Description du ADNc:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 6 with C terminal His tag.
Synonyme du gène:IGFBP-6, Igfbp6
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • Size / Price
    Catalogue : MG50460-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.