After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris IL-11 / interleukin 11 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL11 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008350.2
Taille du ADNc:600bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 11 with N terminal His tag.
Synonyme du gène:IL-11
Espèces:Mouse
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

Références
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • Size / Price
    Catalogue : MG50117-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »