IL12B cDNA ORF Clone, Mouse, C-Myc tag

1/1
Price:
Size:
Number:

IL12B cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 12b with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 1.05kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL12B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL12B cDNA ORF Clone, Mouse, C-Myc tag: Validated Images

IL12B cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

Il-12b cDNA ORF Clone, Mouse; Il-12p40 cDNA ORF Clone, Mouse; Il12p40 cDNA ORF Clone, Mouse; p40 cDNA ORF Clone, Mouse

IL12B Background Information

Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p4) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 4 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.
Full Name
interleukin 12B
References
  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait