After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris IL18BP / IL18BPa expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL18BP Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010531.1
Taille du ADNc:582bp
Description du ADNc:Full length Clone DNA of Mus musculus Interleukin 18 binding protein with N terminal Myc tag.
Synonyme du gène:MC54L, Igifbp, IL-18BP
Espèces:Mouse
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.

Références
  • Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.
  • Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.
  • Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.
  • Size / Price
    Catalogue : MG50206-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »