Commande rapide

Souris IL2/IL-2/Interleukin-2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris IL2 Informations sur les produits clonés de cDNA
    Taille du ADNc:510bp
    Description du ADNc:Full length Clone DNA of Mus musculus interleukin 2 with C terminal His tag.
    Synonyme du gène:IL-2
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    ( We provide with IL2 qPCR primers for gene expression analysis, MP201017 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name

    Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
    Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
  • Size / Price
    Catalogue : MG51061-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.